SubtiBank SubtiBank
dhbA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

dhbA

2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
locus
BSU_32000
pI
5.31
mw
27.34 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
function
biosynthesis of the siderophore bacillibactin
product
2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
essential
no
ec
1.3.1.28
synonyms
entA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    3,291,511 3,292,296

    Phenotypes of a mutant

  • defective in biofilm formation, this can be suppressed by the addition of 2,3-dihydroxybenzoate to the medium [pubmed|31420537]
  • The protein

    Catalyzed reaction/ biological activity

  • (2S,3S)-2,3-dihydroxy-2,3-dihydrobenzoate + NAD+ --> 2,3-dihydroxybenzoate + H+ + NADH (according to UniProt)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Structure

  • [PDB|2FWM] (from E. coli, 42% identity) [pubmed|16790929]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]-[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]
    description
    [Pubmed|8921902]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [pubmed|29914988], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the ''[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]'' operon is strongly unregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • view in new tab

    Biological materials

    Mutant

  • BKE32000 ([gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCAATTCCTTTCT, downstream forward: _UP4_TAACTGAATTTAAAGGAGGT
  • BKK32000 ([gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCAATTCCTTTCT, downstream forward: _UP4_TAACTGAATTTAAAGGAGGT
  • References

  • 8224884,10400588,11112781,11790741,12354229,8921902,8550523,20525796,20817675,21815947,24223955,26110430,29133393,29914988,16790929,31113899,31420537