SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative integrase (fragment), internal part of YdzT
0.00 kDa
protein length
gene length
129 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    652,290 652,418

    Biological materials


  • BKE06036 ([gene|429BEFD297AFD28FA13C4A1871E755F4A23BDB44|ydzT/3]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAAATCTGTCCATTTT, downstream forward: _UP4_TAAAAAAAAATAAAATTTAT
  • BKK06036 ([gene|429BEFD297AFD28FA13C4A1871E755F4A23BDB44|ydzT/3]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAAATCTGTCCATTTT, downstream forward: _UP4_TAAAAAAAAATAAAATTTAT