SubtiBank SubtiBank
ycxA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycxA

unknown
locus
BSU_03530
pI
8.76
mw
44.70 kDa
protein length
409 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    403,217 → 404,443

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • expressed at high cell density ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051]
  • additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C002 (ycxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2000 NBRP B. subtilis, Japan]
  • BKE03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA, downstream forward: _UP4_TCAATATAAAAGGATCAGCA
  • BKK03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA, downstream forward: _UP4_TCAATATAAAAGGATCAGCA
  • References

  • 16091051