SubtiBank SubtiBank
ycxA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycxA

unknown
locus
BSU_03530
pI
8.76
mw
44.70 kDa
protein length
409 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    403,217 → 404,443

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • expressed at high cell density ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051]
  • additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C002 (ycxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2000 NBRP B. subtilis, Japan]
  • BKE03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA, downstream forward: _UP4_TCAATATAAAAGGATCAGCA
  • BKK03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA, downstream forward: _UP4_TCAATATAAAAGGATCAGCA
  • References

  • 16091051