SubtiBank SubtiBank
tlpC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tlpC

membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein
locus
BSU_03440
pI
4.93
mw
61.62 kDa
protein length
573 aa Sequence Blast
gene length
1722 bp Sequence Blast
function
control of chemotaxis
product
methyl-accepting chemotaxis protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    372,771 374,492

    The protein

    [SW|Domains]

  • [SW|HAMP domain] (aa 194-246) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 280-544) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|21515776]
  • Expression and Regulation

    Operons

    genes
    [gene|426253699CA4183F2E1023169C3B80AFA15108E4|tlpC]
    description
    [Pubmed|7921238,7746143]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|7921238], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium,TlpC is present with 5,400 /- 1700 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • BKE03440 ([gene|426253699CA4183F2E1023169C3B80AFA15108E4|tlpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCCCTTTACGA, downstream forward: _UP4_TGATGACTTACTATCATTAT
  • BKK03440 ([gene|426253699CA4183F2E1023169C3B80AFA15108E4|tlpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCCCTTTACGA, downstream forward: _UP4_TGATGACTTACTATCATTAT
  • References

  • 7921238,7746143,21515776,27899502