SubtiBank SubtiBank
truB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

truB

tRNA pseudouridine 55 synthase
locus
BSU_16660
pI
6.65
mw
34.05 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
tRNA modification
product
tRNA pseudouridine 55 synthase
essential
no
synonyms
ylxN,ymxF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,736,886 1,737,815

    The protein

    Catalyzed reaction/ biological activity

  • uridine55 in tRNA --> pseudouridine55 in tRNA (according to UniProt)
  • Protein family

  • pseudouridine synthase TruB family (single member, according to UniProt)
  • Structure

  • [PDB|1ZE1] (from Thermotoga maritima, 36% identity) [pubmed|14990747]
  • Biological materials

    Mutant

  • BKE16660 ([gene|425FC9847D10A6FA9725D6523CD3213C57B371BE|truB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCTTTCACTCCTTC, downstream forward: _UP4_CAATAGAAAAAAGGTGACCG
  • BKK16660 ([gene|425FC9847D10A6FA9725D6523CD3213C57B371BE|truB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCTTTCACTCCTTC, downstream forward: _UP4_CAATAGAAAAAAGGTGACCG
  • References

  • 24371284,7489483,14990747