SubtiBank SubtiBank
yyzK
The papers of the month are back! Check them out! Link here

yyzK

unknown, putative pseudogene
locus
BSU40578
pI
0.00
mw
0.00 kDa
protein length
gene length
144 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,172,259 → 4,172,405

    Biological materials

    Mutant

  • BKE40578 (Δ[gene|42581D2928ABC5870503A95014D5EBA70DB6D384|yyzK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40578 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATGGTTTTGCCATACA, downstream forward: _UP4_GGGTGAGCAAACAAATCCTC
  • BKK40578 (Δ[gene|42581D2928ABC5870503A95014D5EBA70DB6D384|yyzK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40578 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATGGTTTTGCCATACA, downstream forward: _UP4_GGGTGAGCAAACAAATCCTC