SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flagellar hook-length control, substrate specificity switch regulator
47.35 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast
movement and chemotaxis
flagellar hook-length control

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    1,698,278 1,699,741

    Phenotypes of a mutant

  • inactivation of ''[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • no secretion of [protein|F03144BF8A187C8931938A21433431B8961E8EE7|FlgM], permanent inhibition of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD] [Pubmed|25313396]
  • The protein

    Protein family

  • FliK family (single member, according to UniProt)
  • [SW|Localization]

  • flagellum hook (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16270 ([gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTCATTCCCCCTATT, downstream forward: _UP4_GAATGACTTCTATAAGTTCA
  • BKK16270 ([gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTCATTCCCCCTATT, downstream forward: _UP4_GAATGACTTCTATAAGTTCA
  • References


  • 26490009
  • Original publications

  • 14651647,9657996,8157612,15175317,17850253,25313396,24386445,27935957