SubtiBank SubtiBank
carA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

carA

carbamoyl-phosphate transferase-arginine (subunit A)
locus
BSU11230
pI
6.21
mw
38.90 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
function
biosynthesis of arginine
product
carbamoyl-phosphate transferase-arginine (subunit A)
essential
no
ec
6.3.5.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • Gene

    Coordinates
    1,199,327 1,200,388

    The protein

    Catalyzed reaction/ biological activity

  • 2 ATP + L-glutamine + HCO3- + H2O = 2 ADP + phosphate + L-glutamate + carbamoyl phosphate (according to Swiss-Prot)
  • Protein family

  • glutamine amidotransferase type-1 domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E7741ED6F15044900BDC5F0584246469D2D4D586|PyrAA]
  • Structure

  • [PDB|1JDB] (from ''Escherichia coli'', 47% identity, 64% similarity) [Pubmed|10089390]
  • Expression and Regulation

    Operons

    genes
    [gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]-[gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]-[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]-[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]-[gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]-[gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]-[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]
    description
    [Pubmed|7511775]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE11230 ([gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAACAGCCCACCTCTT, downstream forward: _UP4_ATACCAGCAAGGAGAGAAAT
  • BKK11230 ([gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAACAGCCCACCTCTT, downstream forward: _UP4_ATACCAGCAAGGAGAGAAAT
  • References

  • 6096675,12107147,21821766,24843172,1312212,7511775