SubtiBank SubtiBank
comGA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

comGA

late competence protein, traffic ATPase, binds and transports transforming DNA, required for growth arrest of competent cells
locus
BSU_24730
pI
8.89
mw
40.30 kDa
protein length
356 aa Sequence Blast
gene length
1071 bp Sequence Blast
function
genetic competence
product
traffic ATPase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,559,007 2,560,077

    Phenotypes of a mutant

  • loss of [SW|genetic competence]
  • The protein

    Catalyzed reaction/ biological activity

  • binds and transports transforming DNA
  • sequesters [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] during expression of [Pubmed|genetic competence] to inhibit cell elongation during escape from competence [Pubmed|26091431]
  • Protein family

  • GSP E family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-28, Arg-71- and Arg-330 [Pubmed|22517742]
  • Structure

  • [PDB|4PHT] (from Vibrio vulnificus, 38% identity) [pubmed|25092625]
  • [SW|Localization]

  • peripheral membrane protein [Pubmed|9723928]
  • localizes to cell poles in competent cells [Pubmed|16009133]
  • localizes to one cell pole, this depends on [protein|954359717E15DFC106A9D8111C6637E46B16F8C9|ComEB] [Pubmed|31954084,21278288]
  • Additional information

  • ComGA stability depends on [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|21564336]
  • Expression and Regulation

    Operons

    genes
    [gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]-[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
    description
    [Pubmed|26735940,2507524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • BKE24730 ([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGATTCCCTCTCCTT, downstream forward: _UP4_TAGAAAAGTCTGGTTGTTAA
  • BKK24730 ([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGATTCCCTCTCCTT, downstream forward: _UP4_TAGAAAAGTCTGGTTGTTAA
  • BP914 (([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG])::phleo), available in [SW|Fabian Commichau]'s lab
  • GFP fusion

  • GP1640 ''trpC2'' ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''::''spc'' P''comG-gfp'' (''cat''), available in [SW|Jörg Stülke]'s lab
  • GP1643 P''comG-gfp'' (''cat'') in the NCIB3610 background, available in [SW|Jörg Stülke]'s lab
  • PG389 [gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::(p[gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-lacZ gfp cat) [pubmed|26110430], available in [SW|Leendert Hamoen]'s and [SW|Jörg Stülke]'s labs
  • References

    Reviews

  • 15083159,31950915
  • Original publications

  • 11814663,9422590,16009133,11298275,17630974,9723928,21278288,12107147,8196543,2507524,21564336,21707789,22517742,25899641,26091431,25092625,31954084