SubtiBank SubtiBank
comGA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

comGA

late competence protein, traffic ATPase, binds and transports transforming DNA, required for growth arrest of competent cells
locus
BSU_24730
pI
8.89
mw
40.30 kDa
protein length
356 aa Sequence Blast
gene length
1071 bp Sequence Blast
function
genetic competence
product
traffic ATPase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,559,007 2,560,077

    Phenotypes of a mutant

  • loss of [SW|genetic competence]
  • The protein

    Catalyzed reaction/ biological activity

  • binds and transports transforming DNA
  • sequesters [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] during expression of [Pubmed|genetic competence] to inhibit cell elongation during escape from competence [Pubmed|26091431]
  • Protein family

  • GSP E family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-28, Arg-71- and Arg-330 [Pubmed|22517742]
  • Structure

  • [PDB|4PHT] (from Vibrio vulnificus, 38% identity) [pubmed|25092625]
  • [SW|Localization]

  • peripheral membrane protein [Pubmed|9723928]
  • localizes to cell poles in competent cells [Pubmed|16009133]
  • localizes to one cell pole [Pubmed|21278288]
  • Additional information

  • ComGA stability depends on [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|21564336]
  • Expression and Regulation

    Operons

    genes
    [gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]-[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
    description
    [Pubmed|26735940,2507524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • BKE24730 ([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGATTCCCTCTCCTT, downstream forward: _UP4_TAGAAAAGTCTGGTTGTTAA
  • BKK24730 ([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGATTCCCTCTCCTT, downstream forward: _UP4_TAGAAAAGTCTGGTTGTTAA
  • BP914 (([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG])::phleo), available in [SW|Fabian Commichau]'s lab
  • GFP fusion

  • GP1640 ''trpC2'' ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''::''spc'' P''comG-gfp'' (''cat''), available in [SW|Jörg Stülke]'s lab
  • GP1643 P''comG-gfp'' (''cat'') in the NCIB3610 background, available in [SW|Jörg Stülke]'s lab
  • PG389 [gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::(p[gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-lacZ gfp cat) [pubmed|26110430], available in [SW|Leendert Hamoen]'s and [SW|Jörg Stülke]'s labs
  • References

    Reviews

  • 15083159
  • Original publications

  • 11814663,9422590,16009133,11298275,17630974,9723928,21278288,12107147,8196543,2507524,21564336,21707789,22517742,25899641,26091431,25092625