SubtiBank SubtiBank
pbuG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pbuG

hypoxanthin/ guanine permease
locus
BSU06370
pI
8.81
mw
46.03 kDa
protein length
440 aa Sequence Blast
gene length
1323 bp Sequence Blast
function
hypoxanthine and guanine uptake
product
hypoxanthin/ guanine permease
essential
no
synonyms
yebB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    694,662 695,984

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|PbuO]
  • Structure

  • [PDB|2EEW] (the pbuG riboswitch, U47c mutant, bound to hypoxanthine)
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]
    description
    [Pubmed|12923093]

    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|G-box|G-box]: termination, ([protein|C245476CE35028167510F67153F392D91447553F|MgtE riboswitch]) [Pubmed|12923093], in [regulon|G-box|G-box]
  • regulation

  • repressed by hypoxanthine and guanine, [protein|search|PurR]-independent, ([protein|search|G-box])[Pubmed|12923093]
  • view in new tab

    Biological materials

    Mutant

  • BKE06370 ([gene|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTATTTGACTCCCTTC, downstream forward: _UP4_TAAGGAATGAAAAACCAGCT
  • BKK06370 ([gene|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTATTTGACTCCCTTC, downstream forward: _UP4_TAAGGAATGAAAAACCAGCT
  • References

  • 11591660,12923093,11591660,18763711,12923093,12787499