SubtiBank SubtiBank
yqfC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqfC

sporulation protein
locus
BSU_25360
pI
8.97
mw
10.65 kDa
protein length
gene length
282 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,616,667 2,616,948

    Expression and Regulation

    Operons

    genes
    [gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]-[gene|E5F5528DA775DE3EE2DD1EC931CDC7E3781E018C|yqfD]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|12662922,15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE25360 ([gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAGAACCCCCTT, downstream forward: _UP4_TCATAAAGCCGAGGGGGAAA
  • BKK25360 ([gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAGAACCCCCTT, downstream forward: _UP4_TCATAAAGCCGAGGGGGAAA
  • References

  • 12662922,15383836