SubtiBank SubtiBank
yrrL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrrL

potential terminase for peptidoglycan polymerization
locus
BSU_27370
pI
9.65
mw
40.34 kDa
protein length
360 aa Sequence Blast
gene length
1083 bp Sequence Blast
function
determination of peptidoglycan chain length
product
potential terminase for peptidoglycan polymerization
essential
no
synonyms
mltG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,795,887 2,796,969

    The protein

    Catalyzed reaction/ biological activity

  • endolytic transglycosylase [Pubmed|26507882]
  • Protein family

  • transglycosylase MltG family (single member, according to UniProt)
  • Structure

  • [PDB|4IIW] (from ''L. monocytogenes'', 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|41BCD18A1C2D0C69D4445BE14D4617CC61FB23BF|yrrL]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A854 (yrrL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/854 NBRP B. subtilis, Japan]
  • BKE27370 ([gene|41BCD18A1C2D0C69D4445BE14D4617CC61FB23BF|yrrL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGGTCTCCTCCCATCA, downstream forward: _UP4_TAAAAGGAGAGCAAAAAGCT
  • BKK27370 ([gene|41BCD18A1C2D0C69D4445BE14D4617CC61FB23BF|yrrL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGGTCTCCTCCCATCA, downstream forward: _UP4_TAAAAGGAGAGCAAAAAGCT
  • References

  • 14651647,26507882