SubtiBank SubtiBank
yqbT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbT

similar to phage-related protein
locus
BSU_25980
pI
4.32
mw
38.08 kDa
protein length
348 aa Sequence Blast
gene length
1047 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,669,324 2,670,370

    The protein

    Protein family

  • Mu gp47/PBSX xkdT family (with [protein|1234C9BC164FB47E003009E943124982260221C0|XkdT], according to UniProt)
  • Biological materials

    Mutant

  • BKE25980 ([gene|41A236702906A5AEA0ED7B983DEC758E35DFA29F|yqbT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCGATTCATAGGTTT, downstream forward: _UP4_CCTAAATTGGGGCAGGTGAA
  • BKK25980 ([gene|41A236702906A5AEA0ED7B983DEC758E35DFA29F|yqbT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCGATTCATAGGTTT, downstream forward: _UP4_CCTAAATTGGGGCAGGTGAA