SubtiBank SubtiBank
yrvD [2019-02-19 19:04:35]

yrvD [2019-02-19 19:04:35]

12.10 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,825,846 2,826,169

    The protein


  • cell membrane (according to Uniprot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-B517 (yrvD::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2099 (''[gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]''::''zeo''), available in [SW|Jrg Stlke]'s lab
  • BKE27630 ([gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTTTTCCCCCAAAC, downstream forward: _UP4_TAGTTTTCGAATATTATTTG
  • BKK27630 ([gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTTTTCCCCCAAAC, downstream forward: _UP4_TAGTTTTCGAATATTATTTG
  • GP2713 (''[gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]''::''cat''), available in [SW|Jrg Stlke]'s lab
  • FLAG-tag construct

  • GP2440 ''yrvD-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jrg Stlke]'s lab
  • References

  • 15241682