SubtiBank SubtiBank
yrvD [2017-10-25 13:00:47]

yrvD [2017-10-25 13:00:47]

unknown
locus
BSU27630
pI
8.72
mw
12.10 kDa
protein length
107 aa Sequence Blast
gene length
321 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,825,846 → 2,826,169

    The protein

    [SW|Localization]

  • cell membrane (according to Uniprot)
  • Expression and Regulation

    Operons

    genes
    [gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]
    description
    [Pubmed|15241682]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B517 (yrvD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1516 NBRP B. subtilis, Japan]
  • GP2099 (''[gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]''::''zeo''), available in [SW|Jörg Stülke]'s lab
  • BKE27630 (Δ[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTTTTCCCCCAAAC, downstream forward: _UP4_TAGTTTTCGAATATTATTTG
  • BKK27630 (Δ[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTTTTCCCCCAAAC, downstream forward: _UP4_TAGTTTTCGAATATTATTTG
  • FLAG-tag construct

  • GP2440 ''yrvD-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 15241682