SubtiBank SubtiBank
ltaS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ltaS

major polyglycerolphosphate lipoteichoic acid synthase, required for proper colony development
locus
BSU07710
pI
5.20
mw
74.05 kDa
protein length
649 aa Sequence Blast
gene length
1950 bp Sequence Blast
function
biosynthesis of lipoteichoic acid
product
major lipoteichoic acid synthase
essential
no
ec
2.7.8.-
synonyms
yflE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    842,047 843,996

    Phenotypes of a mutant

  • induction of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] and [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX] activities [Pubmed|23103977]
  • reduced [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent expression of ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'' [Pubmed|25288647]
  • extended lag phase [pubmed|29114240]
  • reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]
  • suppression of the growth and morphology defects of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant [pubmed|30478337]
  • The protein

    Protein family

  • LTA synthase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ], [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI], [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS]
  • Modification

  • phosphorylated on Thr-297 [Pubmed|19229300]
  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W8D] [pubmed|19229300]
  • [SW|Localization]

  • cell membrane, at the septum of the cell [Pubmed|15743965]
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C256 (yflE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2254 NBRP B. subtilis, Japan]
  • GP1389 ''ltaS::aphA3'', available in [SW|Jörg Stülke]'s lab
  • GP1396 ''ltaS::tet'', available in [SW|Jörg Stülke]'s lab
  • BKE07710 ([gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT
  • BKK07710 ([gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT
  • References

    Reviews

  • 21388439,21255102,24819367
  • Original publications

  • 19229300,17483484,21255105,19168632,15743965,23103977,25288647,29114240,30478337