SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


major polyglycerolphosphate lipoteichoic acid synthase, required for proper colony development
74.05 kDa
protein length
649 aa Sequence Blast
gene length
1950 bp Sequence Blast
biosynthesis of lipoteichoic acid
major lipoteichoic acid synthase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    842,047 843,996

    Phenotypes of a mutant

  • induction of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] and [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX] activities [Pubmed|23103977]
  • reduced [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent expression of ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'' [Pubmed|25288647]
  • extended lag phase [pubmed|29114240]
  • reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]
  • suppression of the growth and morphology defects of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant [pubmed|30478337]
  • The protein

    Protein family

  • [SW|LTA synthase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ], [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI], [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS]
  • Modification

  • phosphorylated on Thr-297 [Pubmed|19229300]
  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W8D] [pubmed|19229300]
  • [SW|Localization]

  • cell membrane, at the septum of the cell [Pubmed|15743965]
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C256 (yflE::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1389 ''ltaS::aphA3'', available in [SW|Jörg Stülke]'s lab
  • GP1396 ''ltaS::tet'', available in [SW|Jörg Stülke]'s lab
  • BKE07710 ([gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT
  • BKK07710 ([gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTACACTCCTTTTTT, downstream forward: _UP4_TAAGAAAAAGCGGAGAGGTT
  • References


  • 21388439,21255102,24819367
  • Original publications

  • 19229300,17483484,21255105,19168632,15743965,23103977,25288647,29114240,30478337