SubtiBank SubtiBank
yxkD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxkD

unknown
locus
BSU_38840
pI
8.61
mw
30.58 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,987,927 3,988,763

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]
    description
    [Pubmed|10746760]

    regulation

  • induced in the presence of guanidine ([SW|ykkC riboswitch]) [Pubmed|27989440]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yxkD'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B738 (yxkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1737 NBRP B. subtilis, Japan]
  • BKE38840 ([gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGAAAACACTCCTTT, downstream forward: _UP4_TAAAGAAAAATCCCTCTGTA
  • BKK38840 ([gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGAAAACACTCCTTT, downstream forward: _UP4_TAAAGAAAAATCCCTCTGTA
  • References

    Reviews

  • 28060483
  • Original publications

  • 15096624,10746760,21317561,27120414,27989440