SubtiBank SubtiBank
fer [2018-12-07 16:38:58]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fer [2018-12-07 16:38:58]

ferredoxin
locus
BSU23040
pI
3.51
mw
8.73 kDa
protein length
gene length
246 bp Sequence Blast
function
electron transfer
product
ferredoxin
essential
no
synonyms
ypbA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    Coordinates
    2,409,729 → 2,409,977

    The protein

    [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Expression and Regulation

    Operons

    genes
    [gene|4164F07C581320D67FDC1ED5014272B81702A371|fer]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE23040 (Δ[gene|4164F07C581320D67FDC1ED5014272B81702A371|fer]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAAAACCTCCCAGA, downstream forward: _UP4_TAGAAGTAACTAAAAAAAGC
  • BKK23040 (Δ[gene|4164F07C581320D67FDC1ED5014272B81702A371|fer]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAAAACCTCCCAGA, downstream forward: _UP4_TAGAAGTAACTAAAAAAAGC
  • References

  • 12538057