SubtiBank SubtiBank
fer [2018-12-07 16:58:42]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fer [2018-12-07 16:58:42]

8.73 kDa
protein length
gene length
246 bp Sequence Blast
electron transfer

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    2,409,729 → 2,409,977

    The protein


  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1IQZ] (from B. thermoproteolyticus, 83% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE23040 (Δ[gene|4164F07C581320D67FDC1ED5014272B81702A371|fer]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAAAACCTCCCAGA, downstream forward: _UP4_TAGAAGTAACTAAAAAAAGC
  • BKK23040 (Δ[gene|4164F07C581320D67FDC1ED5014272B81702A371|fer]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAAAACCTCCCAGA, downstream forward: _UP4_TAGAAGTAACTAAAAAAAGC
  • References

  • 12538057