SubtiBank SubtiBank
fer [2019-09-03 10:04:22]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

fer [2019-09-03 10:04:22]

8.73 kDa
protein length
gene length
249 bp Sequence Blast
electron transfer

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    2,409,729 2,409,977

    The protein


  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1IQZ] (from B. thermoproteolyticus, 83% identity) [pubmed|11827483]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE23040 ([gene|4164F07C581320D67FDC1ED5014272B81702A371|fer]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAAAACCTCCCAGA, downstream forward: _UP4_TAGAAGTAACTAAAAAAAGC
  • BKK23040 ([gene|4164F07C581320D67FDC1ED5014272B81702A371|fer]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAAAACCTCCCAGA, downstream forward: _UP4_TAGAAGTAACTAAAAAAAGC
  • References

  • 12538057,11827483