SubtiBank SubtiBank
yqbJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbJ

similar to phage-related protein
locus
BSU26090
pI
4.87
mw
16.66 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,681,177 2,681,614

    Biological materials

    Mutant

  • BKE26090 ([gene|415279A8F09E56204E5E7A276419E675043E3338|yqbJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAGCACCGCCTTAAA, downstream forward: _UP4_AAATGATGGCCACTAAAAAA
  • BKK26090 ([gene|415279A8F09E56204E5E7A276419E675043E3338|yqbJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAGCACCGCCTTAAA, downstream forward: _UP4_AAATGATGGCCACTAAAAAA