SubtiBank SubtiBank
ywlG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywlG

affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
locus
BSU_36910
pI
6.48
mw
19.23 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
function
control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
product
unknown
essential
no
synonyms
ipc-33d

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.14|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • Gene

    Coordinates
    3,790,644 3,791,186

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein

    Protein family

  • UPF0340 family (single member, according to UniProt)
  • Structure

  • [PDB|1V8D] (from Thermus thermophilus, 48% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    genes
    [gene|19829F6D993188BE854F0F61CB93777AD04CF754|ywlD]-[gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]-[gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]-[gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A187 (ywlG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/187 NBRP B. subtilis, Japan]
  • BKE36910 ([gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCATTCATTAAACAGC, downstream forward: _UP4_TGAAAGGACTGCATAGCCAG
  • BKK36910 ([gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCATTCATTAAACAGC, downstream forward: _UP4_TGAAAGGACTGCATAGCCAG
  • References

  • 12823818,25755103,29615499