SubtiBank SubtiBank
ywlG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywlG

affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
locus
BSU_36910
pI
6.48
mw
19.23 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
function
control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
product
unknown
essential
no
synonyms
ipc-33d

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.14|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • Gene

    Coordinates
    3,790,644 3,791,186

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein

    Protein family

  • UPF0340 family (single member, according to UniProt)
  • Structure

  • [PDB|1V8D] (from Thermus thermophilus, 48% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    genes
    [gene|19829F6D993188BE854F0F61CB93777AD04CF754|ywlD]-[gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]-[gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]-[gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A187 (ywlG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/187 NBRP B. subtilis, Japan]
  • BKE36910 ([gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCATTCATTAAACAGC, downstream forward: _UP4_TGAAAGGACTGCATAGCCAG
  • BKK36910 ([gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCATTCATTAAACAGC, downstream forward: _UP4_TGAAAGGACTGCATAGCCAG
  • References

  • 12823818,25755103,29615499