SubtiBank SubtiBank
topA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

topA

DNA topoisomerase I
locus
BSU16120
pI
9.02
mw
78.89 kDa
protein length
691 aa Sequence Blast
gene length
2073 bp Sequence Blast
function
relaxation of negatively supercoiled DNA
product
DNA topoisomerase I
essential
yes
ec
5.99.1.2
synonyms
topI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    1,683,661 → 1,685,736

    Phenotypes of a mutant

  • essential [Pubmed|25092907], non-essential according to [Pubmed|28189581], but only one resistance cassette was possible
  • The protein

    Catalyzed reaction/ biological activity

  • relaxation of negatively supercoiled DNA
  • Protein family

  • prokaryotic type I/III topoisomerase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|TopB]
  • [SW|Domains]

  • N-terminal [SW|TOPRIM domain] (aa 3-114) [Pubmed|9722641]
  • Structure

  • [PDB|2GAI] (from ''Thermotoga maritima '', 42% identity) [Pubmed|16600296]
  • additional information

  • [protein|41199C76DF8CA804B7B8878D61228B9542A96AE4|TopA] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • mutations affecting Val-44 (V44D) and Ser-478 (S478P) result in TopA hyperactivity [pubmed|29242163]
  • Expression and Regulation

    Operons

    genes
    [gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]
    description
    [Pubmed|22383849]

    additional information

  • [SW|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • BKK16120 (Δ[gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCCTCAAGA, downstream forward: _UP4_TAGCGGTGAGCAGGGTCTTG
  • Expression vector

  • pGP2060: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • References

  • 17114254,21710567,25092907,16600296,27378778,9722641,28189581,28414321,21710567,29242163