SubtiBank SubtiBank
topA
The papers of the month are back! Check them out! Link here

topA

DNA topoisomerase I
locus
BSU16120
pI
9.02
mw
78.89 kDa
protein length
691 aa Sequence Blast
gene length
2073 bp Sequence Blast
function
relaxation of negatively supercoiled DNA behind RNA polymerase
product
DNA topoisomerase I
essential
yes
ec
5.99.1.2
synonyms
topI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    1,683,661 → 1,685,736

    Phenotypes of a mutant

  • essential [Pubmed|25092907], non-essential according to [Pubmed|28189581], but only one resistance cassette was possible
  • The protein

    Catalyzed reaction/ biological activity

  • relaxation of negatively supercoiled DNA
  • Protein family

  • topo IA family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|TopB]
  • [SW|Domains]

  • N-terminal [SW|TOPRIM domain] (aa 3-114) [Pubmed|9722641]
  • Structure

  • [PDB|4RUL] (from ''E. coli'', 40% identity) [Pubmed|26490962]
  • additional information

  • [protein|41199C76DF8CA804B7B8878D61228B9542A96AE4|TopA] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • mutations affecting Val-44 (V44D) and Ser-478 (S478P) result in TopA hyperactivity [pubmed|29242163]
  • Expression and Regulation

    Operons

    genes
    [gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]
    description
    [Pubmed|22383849]

    additional information

  • [SW|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • BKK16120 (Δ[gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCCTCAAGA, downstream forward: _UP4_TAGCGGTGAGCAGGGTCTTG
  • Expression vector

  • pGP2060: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 6305585,16936698,29177730
  • Original publications

  • 17114254,21710567,25092907,16600296,27378778,9722641,28189581,28414321,21710567,29242163,26490962,25232096,23514156,22923519,10713132,12167668