SubtiBank SubtiBank
degQ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

degQ

stimulates production of degradative enzymes and of extracellular poly-gamma-glutamate, stimulates phosphorylation of DegU by DegS, gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C)
locus
BSU_31720
pI
6.54
mw
5.41 kDa
protein length
gene length
141 bp Sequence Blast
function
regulation of exoenzyme synthesis
product
pleiotropic regulator
essential
no
synonyms
sacQ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • Gene

    Coordinates
    3,257,092 3,257,232

    Phenotypes of a mutant

  • loss of poly-gamma-glutamate production [Pubmed|16091050], no synthesis of nonribosomal peptides iturin A and plipastatin [http://www.ncbi.nlm.nih.gov/sites/entrez/16251307 PubMed1] [http://www.ncbi.nlm.nih.gov/sites/entrez/10471562 PubMed2], reduced synthesis of degradative enzymes [Pubmed|3098732], increased genetic competence [Pubmed|3098732]
  • The protein

    Catalyzed reaction/ biological activity

  • stimulates autophosphorylation of [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS] [Pubmed|21965392]
  • Protein family

  • degQ family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]
    description
    [Pubmed|3007431]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3007431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|1901055], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [Pubmed|1901055], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • controlled by [protein|search|DegU] [Pubmed|1901055]
  • additional information

  • the gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C) [http://www.ncbi.nlm.nih.gov/sites/entrez/16091050 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • QB4851 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT, downstream forward: _UP4_TGAAAAAGACTTGGAAACAA
  • BKK31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT, downstream forward: _UP4_TGAAAAAGACTTGGAAACAA
  • References

  • 17850253,2428811,19447339,3007431,1901055,16091050,21278284,21965392,26302846,27920766,31272833