SubtiBank SubtiBank
degQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

degQ

stimulates production of degradative enzymes and of extracellular poly-gamma-glutamate, stimulates phosphorylation of DegU by DegS, gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C)
locus
BSU31720
pI
6.54
mw
5.41 kDa
protein length
gene length
141 bp Sequence Blast
function
regulation of exoenzyme synthesis
product
pleiotropic regulator
essential
no
synonyms
sacQ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • Gene

    Coordinates
    3,257,092 3,257,232

    Phenotypes of a mutant

  • loss of poly-gamma-glutamate production [Pubmed|16091050], no synthesis of nonribosomal peptides iturin A and plipastatin [http://www.ncbi.nlm.nih.gov/sites/entrez/16251307 PubMed1] [http://www.ncbi.nlm.nih.gov/sites/entrez/10471562 PubMed2], reduced synthesis of degradative enzymes [Pubmed|3098732], increased genetic competence [Pubmed|3098732]
  • The protein

    Catalyzed reaction/ biological activity

  • stimulates autophosphorylation of [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS] [Pubmed|21965392]
  • Protein family

  • degQ family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]
    description
    [Pubmed|3007431]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3007431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|1901055], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [Pubmed|1901055], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • controlled by [protein|search|DegU] [Pubmed|1901055]
  • additional information

  • the gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C) [http://www.ncbi.nlm.nih.gov/sites/entrez/16091050 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • QB4851 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT, downstream forward: _UP4_TGAAAAAGACTTGGAAACAA
  • BKK31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT, downstream forward: _UP4_TGAAAAAGACTTGGAAACAA
  • References

  • 17850253,2428811,19447339,3007431,1901055,16091050,21278284,21965392,26302846,27920766