SubtiBank SubtiBank
spoVV
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoVV

transporter for dipicolinic acid across the outer forespore membrane
locus
BSU_15030
pI
10.27
mw
44.68 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
transport of dipicolinic acid across the outer forespore membrane
product
dipicolinic acid transporter
essential
no
synonyms
ylbJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,570,574 1,571,800

    Phenotypes of a mutant

  • inactivation of ''[gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV]'' eliminates [SW|sporulation] [Pubmed|26735940], this can be suppressed by inactivation of the genes of the [gene|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]-[gene|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]-[gene|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC] operon [pubmed|28605069]
  • The protein

    Catalyzed reaction/ biological activity

  • transport of dipicolinic acid across the outer forespore membrane [pubmed|28945739]
  • [SW|Localization]

  • outer forespore membrane [pubmed|28945739]
  • Expression and Regulation

    Operons

    genes
    [gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|12662922,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B246 (ylbJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1245 NBRP B. subtilis, Japan]
  • BKE15030 ([gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTACCTCCCCGATGC, downstream forward: _UP4_ACAAAAAAAGGATGAGTCAA
  • BKK15030 ([gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTACCTCCCCGATGC, downstream forward: _UP4_ACAAAAAAAGGATGAGTCAA
  • References

  • 12662922,15699190,15383836,26735940,28605069,28945739