SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|cell shape]-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|LytE] activity
35.53 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
[SW|cell shape] determation
[SW|cell shape]-determining protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,516,574 1,517,581

    The protein

    Catalyzed reaction/ biological activity

  • forms ring-shaped filaments in a heterologous system [Pubmed|21091501]
  • required for the activity of [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|LytE] [Pubmed|23869552,16950129]
  • Protein family

  • [SW|FtsA/MreB family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl], [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB]
  • Structure

  • [PDB|1JCF] ([protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] from ''Thermotoga maritima'', 52% identity) [Pubmed|11544518]
  • [SW|Localization]

  • during logarithmic growth, [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH] forms discrete patches thst move processively along peripheral tracks perpendicular to the cell axis [Pubmed|21636744]
  • forms transverse bands as cells enter the stationary phase [Pubmed|21636744]
  • close to the inner surface of the cytoplasmic membrane [Pubmed|16950129]
  • reports on helical structures formed by MreBH [Pubmed|16950129,20566861] seem to be misinterpretation of data [Pubmed|21636744]
  • normal localization depends on the presence of glucolipids, [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] forms irregular clusters in an ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutant [Pubmed|22362028]
  • Expression and Regulation



    sigma factors

  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|18156261], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|24125693], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expression is increased in an [gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP] mutant [Pubmed|22362028]
  • induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [Pubmed|24125693,18156261]
  • view in new tab

    Biological materials


  • BKE14470 ([gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCCAATCTCT, downstream forward: _UP4_TAGTCTTTACCCGCAAAATT
  • BKK14470 ([gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCACCCAATCTCT, downstream forward: _UP4_TAGTCTTTACCCGCAAAATT
  • References


  • 17064365,20566861,21636744,21636745,22362028
  • Other original publications

  • 16950129,19643765,19659933,21091501,22069484,23879732,23869552,24125693,11544518,18156261,22362028,27965289,29914988