SubtiBank SubtiBank
cgeB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cgeB

maturation of the outermost layer of the spore
locus
BSU_19790
pI
6.57
mw
36.70 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
function
maturation of the outermost layer of the spore
product
unknown
essential
no
synonyms
cgeAB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,149,084 2,150,037

    Expression and Regulation

    Operons

    genes
    [gene|9D3D72FDF028A8468A92C583138397A5BD2FED59|cgeA]-[gene|405FD4EA1A5B2B3512F973981EF62CB37664B5F8|cgeB]
    description
    [Pubmed|7592393]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7592393,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7592393], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|7592393]
  • view in new tab

    Biological materials

    Mutant

  • BKE19790 ([gene|405FD4EA1A5B2B3512F973981EF62CB37664B5F8|cgeB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATATACAAGACTTTCATCG, downstream forward: _UP4_TGAAAAATCGTTCATTGCTA
  • BKK19790 ([gene|405FD4EA1A5B2B3512F973981EF62CB37664B5F8|cgeB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATATACAAGACTTTCATCG, downstream forward: _UP4_TGAAAAATCGTTCATTGCTA
  • References

  • 7592393,15699190,30582883