SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flagellar-specific ATPase for the export of flagellar proteins
47.71 kDa
protein length
438 aa Sequence Blast
gene length
1317 bp Sequence Blast
export of flagellar proteins
flagellar-specific ATPase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    1,695,877 1,697,193

    Phenotypes of a mutant

  • loss of motility [Pubmed|26296725]
  • a mutant has been selected during growth at low pressure [Pubmed|26296725]
  • inactivation of ''[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + 4 H+ + H2O --> ADP + 5 H+ + phosphate (according to UniProt)
  • Protein family

  • ATPase alpha/beta chains family (with [protein|E3FADE979CE6AB6315F67812608FCE00CF4E2453|AtpA] and [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD], according to UniProt)
  • Structure

  • [PDB|2DPY] (from ''Salmonella enterica'', 50% identity) [Pubmed|17202259]
  • [SW|Localization]

  • cytoplasm, as part of the flagellum attached to the membrane [Pubmed|26490009]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16240 ([gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACAATCTATCAGACTCTGTG, downstream forward: _UP4_TTGACAGGAAATGAGGAATA
  • BKK16240 ([gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACAATCTATCAGACTCTGTG, downstream forward: _UP4_TTGACAGGAAATGAGGAATA
  • References


  • 24064315,18931786,26490009
  • Original publications

  • 14651647,9657996,8157612,15175317,17850253,21821766,24386445,26296725,17202259,12787361,21278755,10998179,27935957