SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


SP prophage-derived DNA-binding protein HU 2
9.71 kDa
protein length
gene length
279 bp Sequence Blast
untwisting of the DNA double helix
DNA-binding protein HU 2

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,225,337 2,225,615

    The protein

    Catalyzed reaction/ biological activity

  • [protein|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|YonN]-mediated untwisting of the DNA stimulates [protein|C352560155F5B2E951B5059794D7B319C1A3AF2C|Nth] endonuclease activity at AP sites [Pubmed|21954439]
  • Protein family

  • bacterial histone-like protein family (with [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs], according to UniProt)
  • Paralogous protein(s)

  • [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs]
  • Structure

  • [PDB|1HUE] ([protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs] from B. stearothermophilus, 71% identity) [pubmed|7500343]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE21050 ([gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAATTTCCTCCTAA, downstream forward: _UP4_TAATCAGTTAATGAGGACGA
  • BKK21050 ([gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAATTTCCTCCTAA, downstream forward: _UP4_TAATCAGTTAATGAGGACGA
  • References

  • 21954439,7500343