SubtiBank SubtiBank
yonN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yonN

SP prophage-derived DNA-binding protein HU 2
locus
BSU_21050
pI
10.23
mw
9.71 kDa
protein length
gene length
279 bp Sequence Blast
function
untwisting of the DNA double helix
product
DNA-binding protein HU 2
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,225,337 2,225,615

    The protein

    Catalyzed reaction/ biological activity

  • [protein|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|YonN]-mediated untwisting of the DNA stimulates [protein|C352560155F5B2E951B5059794D7B319C1A3AF2C|Nth] endonuclease activity at AP sites [Pubmed|21954439]
  • Protein family

  • bacterial histone-like protein family (with [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs], according to UniProt)
  • Paralogous protein(s)

  • [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs]
  • Structure

  • [PDB|1HUE] ([protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs] from B. stearothermophilus, 71% identity) [pubmed|7500343]
  • Expression and Regulation

    Operons

    genes
    [gene|121C3C9CF49711316A526B9571F020BE8E304B31|yonP]-[gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]-[gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE21050 ([gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAATTTCCTCCTAA, downstream forward: _UP4_TAATCAGTTAATGAGGACGA
  • BKK21050 ([gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAATTTCCTCCTAA, downstream forward: _UP4_TAATCAGTTAATGAGGACGA
  • References

  • 21954439,7500343