SubtiBank SubtiBank
ydeO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeO

unknown
locus
BSU_05280
pI
8.67
mw
31.28 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    574,690 575,562

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3FB64EB5C7BEBC89C99B141D47F766CF82541E18|ydeO]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE05280 ([gene|3FB64EB5C7BEBC89C99B141D47F766CF82541E18|ydeO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCATTCCTCATTTCTC, downstream forward: _UP4_TAAAAAATAGAATGACCTTT
  • BKK05280 ([gene|3FB64EB5C7BEBC89C99B141D47F766CF82541E18|ydeO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCATTCCTCATTTCTC, downstream forward: _UP4_TAAAAAATAGAATGACCTTT
  • GP2753 ([gene|3FB64EB5C7BEBC89C99B141D47F766CF82541E18|ydeO]::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP2757 ([gene|3FB64EB5C7BEBC89C99B141D47F766CF82541E18|ydeO]::''phleo''), available in [SW|Jörg Stülke]'s lab