SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


immunity protein, protection against SdpC
23.15 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
protection against SdpC
immunity protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,466,434 3,467,057

    The protein

    Paralogous protein(s)

  • [protein|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|YfhL], [protein|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|YbgB]
  • Effectors of protein activity

  • in the presence of extracellular [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC], [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|SdpI] binds and sequesters [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR] , this results in induction of the ''[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]'' operon [Pubmed|16469701]
  • [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16469701], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|16469701], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: repression, [Pubmed|16469701], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • induced by extracellular [protein|search|SdpC] ([protein|search|SdpR]) [Pubmed|16469701]
  • view in new tab

    Biological materials


  • MGNA-A454 (yvaZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT, downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
  • BKK33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT, downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
  • References


  • 20955377
  • Original Publications

  • 12817086,16469701,20563570