SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


nitrate reductase (electron transfer subunit)
84.57 kDa
protein length
771 aa Sequence Blast
gene length
2316 bp Sequence Blast
utilization of nitrate
nitrate reductase (electron transfer subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of nitrate/ nitrite]
  • Gene

    360,442 362,757

    The protein

    Paralogous protein(s)

  • [protein|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|NasD]
  • [SW|Cofactors]

  • FAD [Pubmed|11289299]
  • Structure

  • [PDB|3KLJ] (from Clostridium acetobutylicum, corresponds to aa 2 ... 371, 27% identity) [pubmed|20017214]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • 1A971 ( ''nasB''::''erm''), [Pubmed|7868621], available at [ BGSC]
  • BKE03320 ([gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATCAGACCTCCTTTG, downstream forward: _UP4_TGAGGCATTTTGACTGAACG
  • BKK03320 ([gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATCAGACCTCCTTTG, downstream forward: _UP4_TGAGGCATTTTGACTGAACG
  • References


  • 22103536,11289299
  • Original publications

  • 7836289,12823818,7868621,25755103,8799114,16885456,20017214