SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


bacilysin biosynthesis protein, prephenate decarboxylase
23.18 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast
biosynthesis of the antibiotic bacilysin
anticapsin biosynthesis protein, prephenate decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    3,873,566 3,874,180

    The protein

    Catalyzed reaction/ biological activity

  • decarboxylation of prephenate [Pubmed|19776011]
  • H+ + prephenate --> 3-[(4R)-4-hydroxycyclohexa-1,5-dien-1-yl]-2-oxopropanoate + CO2 (according to UniProt)
  • Protein family

  • prephenate decarboxylase family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-B239 (ywfB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37740 ([gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGCACCAACCAATCTT, downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
  • BKK37740 ([gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGCACCAACCAATCTT, downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
  • References

  • 15609023,12399481,12372825,21948839,19776011,19801406,20052993,12697329,21709425,31113899