SubtiBank SubtiBank
bacA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bacA

bacilysin biosynthesis protein, prephenate decarboxylase
locus
BSU37740
pI
7.90
mw
23.18 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast
function
biosynthesis of the antibiotic bacilysin
product
anticapsin biosynthesis protein, prephenate decarboxylase
essential
no
synonyms
ywfB,ipa-80d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,873,566 3,874,180

    The protein

    Catalyzed reaction/ biological activity

  • decarboxylation of prephenate [Pubmed|19776011]
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B239 (ywfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1238 NBRP B. subtilis, Japan]
  • BKE37740 ([gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGCACCAACCAATCTT, downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
  • BKK37740 ([gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGCACCAACCAATCTT, downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
  • References

  • 15609023,12399481,12372825,21948839,19776011,19801406,20052993,12697329,21709425,31113899