SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


metal-dependent exonuclease, part of a novel nucleotide excision repair pathway
47.83 kDa
protein length
413 aa Sequence Blast
gene length
1242 bp Sequence Blast
mitomycin C-specific DNA damage repair
metal-dependent exonuclease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,333,324 2,334,565

    Phenotypes of a mutant

  • sensitive to mitomycin C [pubmed|30379365]
  • The protein


  • Mg2+ [pubmed|30379365]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A413 (yprB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22210 ([gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGACATATCCGGCCTCC, downstream forward: _UP4_TAAATATTCCCCGGGAAAGC
  • BKK22210 ([gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGACATATCCGGCCTCC, downstream forward: _UP4_TAAATATTCCCCGGGAAAGC
  • References

    Research papers

  • 30379365