SubtiBank SubtiBank
mrfB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mrfB

metal-dependent exonuclease, part of a novel nucleotide excision repair pathway
locus
BSU22210
pI
7.16
mw
47.83 kDa
protein length
413 aa Sequence Blast
gene length
1239 bp Sequence Blast
function
mitomycin C-specific DNA damage repair
product
metal-dependent exonuclease
essential
no
synonyms
yprB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,333,324 → 2,334,565

    Phenotypes of a mutant

  • sensitive to mitomycin C [pubmed|30379365]
  • The protein

    [SW|Cofactors]

  • Mg2+ [pubmed|30379365]
  • Expression and Regulation

    Operons

    genes
    [gene|4D286C045A43FBF0F6E93E9E46AD7F25E35ADA7C|mrfA]-[gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]-[gene|FA8D9AA0968365522DEFC05B277123FC96482044|cotD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A413 (yprB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/413 NBRP B. subtilis, Japan]
  • BKE22210 (Δ[gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGACATATCCGGCCTCC, downstream forward: _UP4_TAAATATTCCCCGGGAAAGC
  • BKK22210 (Δ[gene|3F1D78CAAA4B5057DEBB24C4D382F96DA4AA4852|mrfB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGACATATCCGGCCTCC, downstream forward: _UP4_TAAATATTCCCCGGGAAAGC
  • References

    Research papers

  • 30379365