SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


8.36 kDa
protein length
gene length
246 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,490,939 1,491,184

    The protein

    Protein family

  • UPF0180 family (single member, according to UniProt)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BKE14200 ([gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGAACACCTCCGTT, downstream forward: _UP4_TAATAAAAAAACCGAAGCAA
  • BKK14200 ([gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGAACACCTCCGTT, downstream forward: _UP4_TAATAAAAAAACCGAAGCAA