SubtiBank SubtiBank
ykuS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykuS

unknown
locus
BSU_14200
pI
4.01
mw
8.36 kDa
protein length
gene length
246 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,490,939 1,491,184

    The protein

    Protein family

  • UPF0180 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|716FE06124544C05CC34BA2E643B4DBD27F04998|ykuQ]-[gene|D6F1906CE8386F78F451D6B794F74DE4AD25AC9C|ykuR]-[gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14200 ([gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGAACACCTCCGTT, downstream forward: _UP4_TAATAAAAAAACCGAAGCAA
  • BKK14200 ([gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGAACACCTCCGTT, downstream forward: _UP4_TAATAAAAAAACCGAAGCAA