SubtiBank SubtiBank
gerD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerD

scaffold of the germinosome, required for clustering of germinant receptors in the spore inner membrane
locus
BSU_01550
pI
4.86
mw
20.97 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
germination
product
lipoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    158,515 159,072

    Phenotypes of a mutant

  • defective in [SW|germination] in response to nutrients [Pubmed|24530795]
  • The protein

    Catalyzed reaction/ biological activity

  • required for clustering of germinant receptors in the spore inner membrane [Pubmed|21696470]
  • [SW|Domains]

  • has an N-terminal signal sequence and a signal for fixation to lipid [Pubmed|23335419]
  • Structure

  • [PDB|4O8W] [Pubmed|24530795]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419,21696470]
  • inner spore membrane, spore coat, cortex, germ cell wall, some GerD is also present in the soluble fraction [Pubmed|19332816]
  • Additional information

  • 3,500 molecules are present per spore [Pubmed|23749970]
  • Expression and Regulation

    Operons

    genes
    [gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]
    description
    [Pubmed|2517635]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1906867,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expression level depends on sporulation conditions (medim composition, temperature) [Pubmed|22327596]
  • additional information

  • 3,500 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • 1A677 ( ''gerD''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A677&Search=1A677 BGSC]
  • 1G17 ( ''gerD''::''spec''), [Pubmed|15126458], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G17&Search=1G17 BGSC]
  • BKE01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC, downstream forward: _UP4_TAAAGGGAAAGCCGGGATCT
  • BKK01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC, downstream forward: _UP4_TAAAGGGAAAGCCGGGATCT
  • Antibody

  • available in [SW|Anne Moir] lab
  • labs

  • [SW|Anne Moir], University of Sheffield, UK
  • References

  • 1906867,19332816,17122337,21725007,18556788,19332816,2517635,21696470,22327596,22493018,23335419,23749970,21398556,24530795,24752279,26731423