SubtiBank SubtiBank
yjjA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjjA

similar to uroporphyrinogen III synthase
locus
BSU_12230
pI
5.14
mw
29.68 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
function
unknown
product
similar to uroporphyrinogen III synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,294,138 1,294,950

    The protein

    Structure

  • [PDB|1WD7] (from Thermus thermophilus, 36% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A364 (yjjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/364 NBRP B. subtilis, Japan]
  • BKE12230 ([gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTTTCCTCTCCTC, downstream forward: _UP4_TAACAAGTACAAAAAGCCGC
  • BKK12230 ([gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTTTCCTCTCCTC, downstream forward: _UP4_TAACAAGTACAAAAAGCCGC