SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to uroporphyrinogen III synthase
29.68 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
similar to uroporphyrinogen III synthase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,294,138 1,294,950

    The protein


  • [PDB|1WD7] (from Thermus thermophilus, 36% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A364 (yjjA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12230 ([gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTTTCCTCTCCTC, downstream forward: _UP4_TAACAAGTACAAAAAGCCGC
  • BKK12230 ([gene|3E567AD4C402CDFD544836D79DFA47BC6AE66A8F|yjjA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCGTTTCCTCTCCTC, downstream forward: _UP4_TAACAAGTACAAAAAGCCGC