SubtiBank SubtiBank
pta
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pta

phosphotransacetylase
locus
BSU_37660
pI
4.65
mw
34.64 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
function
overflow metabolism
product
phosphotransacetylase
essential
no
ec
2.3.1.8
synonyms
ipa-88d,ywfJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,865,355 3,866,326

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + phosphate --> acetyl phosphate + CoA (according to UniProt)
  • Protein family

  • phosphate acetyltransferase and butyryltransferase family (with [protein|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|Ptb], according to UniProt)
  • Modification

  • phosphorylation on (Ser-123 OR Thr-128 OR Ser-129) [Pubmed|17218307]
  • Structure

  • [PDB|1XCO] (complex with acetylphosphate)[pubmed|16283428]
  • [PDB|1TD9]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|3E343C05EE6FF04D5A54066E19DC6576784E09E7|pta]
    description
    [Pubmed|10423526]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10423526], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|12850135,10559153], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression activated by glucose (2.6 fold) (CcpA) [Pubmed|12850135,10559153]
  • view in new tab

    Biological materials

    Mutant

  • GP668 (aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE37660 ([gene|3E343C05EE6FF04D5A54066E19DC6576784E09E7|pta]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAACCTCCTCAAA, downstream forward: _UP4_TAATAAAATTGAAGACAATG
  • BKK37660 ([gene|3E343C05EE6FF04D5A54066E19DC6576784E09E7|pta]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAACCTCCTCAAA, downstream forward: _UP4_TAATAAAATTGAAGACAATG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 15755952,26098117,16283428,30265683,10423526,17218307,12850135,10559153