SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


10.90 kDa
protein length
gene length
285 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    238,164 238,448

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation




  • the mRNA is processed between [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG] and [gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B966 (ybfE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02180 ([gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAGAATACCTTTAAT, downstream forward: _UP4_TAATCTCGAAATCAGAGATG
  • BKK02180 ([gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAGAATACCTTTAAT, downstream forward: _UP4_TAATCTCGAAATCAGAGATG