SubtiBank SubtiBank
yhaO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhaO

similar to DNA double-strand break repair protein
locus
BSU_09910
pI
5.23
mw
46.65 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
sbcF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    1,064,846 1,066,072

    The protein

    Protein family

  • [SW|Metallophosphoesterase superfamily] (according to UniProt)
  • Structure

  • [PDB|4TUG] (from Methanocaldococcus jannaschii, corresponds to aa 5 - 290, 27% identity) [pubmed|25107472]
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|3E27C881BB3DE3FD55B7AD21B8771A859D80786F|yhaO]-[gene|709C4D0AE9C78C9A367F37B9C3B37D2516850D7C|sbcE]-[gene|6D585EB5E56A1E5C1C31680D960043BA08C817E2|yhaM]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A664 (yhaO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/664 NBRP B. subtilis, Japan]
  • BKE09910 ([gene|3E27C881BB3DE3FD55B7AD21B8771A859D80786F|yhaO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCTCCTTTCCAGGA, downstream forward: _UP4_CTTAAGGTGCTTGATACATG
  • BKK09910 ([gene|3E27C881BB3DE3FD55B7AD21B8771A859D80786F|yhaO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCTCCTTTCCAGGA, downstream forward: _UP4_CTTAAGGTGCTTGATACATG
  • References

  • 16267290,16479537,25107472