SubtiBank SubtiBank
yhaO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhaO

similar to DNA double-strand break repair protein
locus
BSU_09910
pI
5.23
mw
46.65 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
sbcF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    1,064,846 1,066,072

    The protein

    Protein family

  • [SW|Metallophosphoesterase superfamily] (according to UniProt)
  • Structure

  • [PDB|4TUG] (from Methanocaldococcus jannaschii, corresponds to aa 5 - 290, 27% identity) [pubmed|25107472]
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|3E27C881BB3DE3FD55B7AD21B8771A859D80786F|yhaO]-[gene|709C4D0AE9C78C9A367F37B9C3B37D2516850D7C|sbcE]-[gene|6D585EB5E56A1E5C1C31680D960043BA08C817E2|yhaM]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A664 (yhaO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/664 NBRP B. subtilis, Japan]
  • BKE09910 ([gene|3E27C881BB3DE3FD55B7AD21B8771A859D80786F|yhaO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCTCCTTTCCAGGA, downstream forward: _UP4_CTTAAGGTGCTTGATACATG
  • BKK09910 ([gene|3E27C881BB3DE3FD55B7AD21B8771A859D80786F|yhaO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCTCCTTTCCAGGA, downstream forward: _UP4_CTTAAGGTGCTTGATACATG
  • References

  • 16267290,16479537,25107472