SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


threonyl-tRNA synthetase (major)
73.34 kDa
protein length
643 aa Sequence Blast
gene length
1932 bp Sequence Blast
threonyl-tRNA synthetase (major)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Aminoacyl-tRNA synthetases]
  • Gene

    2,959,257 2,961,188

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-threonine + tRNAThr --> AMP + diphosphate + H+ + L-threonyl-tRNAThr (according to UniProt)
  • Protein family

  • [SW|Class-II aminoacyl-tRNA synthetase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CA74CB721842927F67FBC3B5C27D2EE46B30CE1C|ThrZ]:
  • [SW|Domains]

  • [SW|TGS domain] (aa 3-64) (according to UniProt)
  • Modification

  • Cys573 is S-bacillithiolated by NaOCl stress [Pubmed|22938038]
  • Structure

  • [PDB|1TJE] (from ''Escherichia coli'', 44% identity, 63% similarity) [Pubmed|15525511]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8288542], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • expression transiently increases in the forespore [Pubmed|22848659]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    view in new tab

    Biological materials


  • BKE28950 ([gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGTCACTCCTTTTT, downstream forward: _UP4_TAAAATAAAAAAGCATGATC
  • BKK28950 ([gene|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|thrS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGTCACTCCTTTTT, downstream forward: _UP4_TAAAATAAAAAAGCATGATC
  • References

  • 22938038,8288542,1379177,19258532,7476165,12136084,8969504,17114254,22848659,15378759,29794222