SubtiBank SubtiBank
yfmI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmI

similar to macrolide-efflux transporter
locus
BSU_07460
pI
10.00
mw
45.45 kDa
protein length
406 aa Sequence Blast
gene length
1221 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    819,311 820,531

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]-[gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|3DFC1A118B346C7939851BF711FFA31E04A698E8|YfmI]' and '[protein|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|YfmG]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C242 (yfmI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2240 NBRP B. subtilis, Japan]
  • BKE07460 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCTCCCTTGGA, downstream forward: _UP4_TAATAAATATATAAAATTTA
  • BKK07460 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCTCCCTTGGA, downstream forward: _UP4_TAATAAATATATAAAATTTA
  • GP2580 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 14651647,20525796,20817675