SubtiBank SubtiBank
yfmI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfmI

similar to macrolide-efflux transporter
locus
BSU_07460
pI
10.00
mw
45.45 kDa
protein length
406 aa Sequence Blast
gene length
1221 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    819,311 820,531

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]-[gene|B61458337D96A0CF8D0778A03A0DB68B566913D8|yfmJ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|3DFC1A118B346C7939851BF711FFA31E04A698E8|YfmI]' and '[protein|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|YfmG]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C242 (yfmI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2240 NBRP B. subtilis, Japan]
  • BKE07460 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCTCCCTTGGA, downstream forward: _UP4_TAATAAATATATAAAATTTA
  • BKK07460 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCTCCCTTGGA, downstream forward: _UP4_TAATAAATATATAAAATTTA
  • GP2580 ([gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 14651647,20525796,20817675