SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|RNA polymerase ][SW|sigma factor ]SigI
29.04 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
control of a class of heat shock genes
[SW|RNA polymerase ][SW|sigma factor ]SigI

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    1,411,892 1,412,647

    Phenotypes of a mutant

  • temperature-sensitive growth on agar plates [Pubmed|11157964]
  • The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • Structure

  • [PDB|6IVU] (from Hungateiclostridium thermocellum, corresponds to aa 141 ... 245, 38% identity) [pubmed|31106374]
  • [SW|Localization]

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Additional information

  • overexpression of SigI suppresses ''[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] [gene|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|mreBH] [gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]'' mutants [Pubmed|19114499]
  • Expression and Regulation



    sigma factors

  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|17185538], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|23199363], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|24125693,23199363], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [Pubmed|23199363,17185538]
  • view in new tab

    Biological materials


  • MGNA-A229 (ykoZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13450 ([gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA, downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA
  • BKK13450 ([gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCAGTTCCTCCCTATA, downstream forward: _UP4_TATCTTAAAGGGGTGCTGCA
  • References

  • 19114499,17185538,11157964,18156261,21541672,24125693,23199363,26744224,28333276,29914988,31106374