SubtiBank SubtiBank
mmgD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mmgD

2-methylcitrate synthase
locus
BSU_24140
pI
6.20
mw
41.95 kDa
protein length
372 aa Sequence Blast
gene length
1119 bp Sequence Blast
function
mother cell metabolism
product
2-methylcitrate synthase
essential
no
ec
2.3.3.5
synonyms
yqiO,prpC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,509,654 2,510,772

    The protein

    Catalyzed reaction/ biological activity

  • Propanoyl-CoA + H2O + oxaloacetate --> 2-methylcitrate + CoA [pubmed|28956599]
  • does also have (albeit weaker) citrate synthase activity [pubmed|28956599]
  • acetyl-CoA + H2O + oxaloacetate --> citrate + CoA + H+ (according to UniProt)
  • Protein family

  • citrate synthase family (with [protein|6684F6083B001E9FDC5967799B715AE966B83E1D|CitA] and [protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ], according to UniProt)
  • Paralogous protein(s)

  • [protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ], [protein|6684F6083B001E9FDC5967799B715AE966B83E1D|CitA]
  • Structure

  • [PDB|3HWK] (from Mycobacterium tuberculosis, 38% identity) [pubmed|25613812]
  • Expression and Regulation

    Operons

    genes
    [gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
    description
    [Pubmed|8759838]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • BKE24140 ([gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCTCAACCTCCGTTT, downstream forward: _UP4_AAATCATGAAAGGAGCTGGT
  • BKK24140 ([gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCTCAACCTCCGTTT, downstream forward: _UP4_AAATCATGAAAGGAGCTGGT
  • References

  • 8759838,15699190,25613812,28956599