SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon
22.07 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon ([SW|TetR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    2,777,070 2,777,654

    The protein

    Protein family

  • [SW|TetR family]
  • [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 6-66) (according to UniProt)
  • Modification

  • phosphorylated by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] on Tyr-45, this results in displacement of FatR from the DNA [Pubmed|23939619]
  • Structure

  • [PDB|4ME9] (from B. cereus, 38% identity)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421,12775685], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR]: repression, [Pubmed|11734890], in [regulon|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab



  • Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials


  • MGNA-A177 (yrhI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC, downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT
  • BKK27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC, downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT
  • References

  • 11734890,11574077,11377867,10917605,12207695,9636707,23939619,21926231