SubtiBank SubtiBank
fatR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fatR

transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon
locus
BSU_27170
pI
5.62
mw
22.07 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
function
unknown
product
transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon ([SW|TetR family])
essential
no
synonyms
yrhI,bscR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,777,070 2,777,654

    The protein

    Protein family

  • [SW|TetR family]
  • [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 6-66) (according to UniProt)
  • Modification

  • phosphorylated by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] on Tyr-45, this results in displacement of FatR from the DNA [Pubmed|23939619]
  • Structure

  • [PDB|4ME9] (from B. cereus, 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
    description
    [Pubmed|10917605]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421,12775685], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR]: repression, [Pubmed|11734890], in [regulon|3DA3FFB295F5513A220CB163994EE0F356C810E6|FatR regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    genes
    [gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]-[gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
    description
    [Pubmed|18179421]

    regulation

  • Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A177 (yrhI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/177 NBRP B. subtilis, Japan]
  • BKE27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC, downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT
  • BKK27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC, downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT
  • References

  • 11734890,11574077,11377867,10917605,12207695,9636707,23939619,21926231