SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|RNA polymerase] ECF-type [SW|sigma factor] SigW, required for the adaptation to membrane active agents, activated by alkaline shock and by polymyxin B, vancomycin, cephalosporin C, D-cycloserine, and triton X-100
21.57 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast
adaptation to membrane-active compounds
[SW|RNA polymerase] ECF-type [SW|sigma factor] SigW

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    194,849 195,412

    Phenotypes of a mutant

  • sensitive to -lactam antibiotics such as cefuroxime and to fosfomycin [Pubmed|22178969]
  • Inactivation of ''[gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]'', ''[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]'' and ''[gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]'' increases competitive fitness of ''Bacillus subtilis'' under non-sporulating conditions [Pubmed|22344650]
  • The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|ECF subfamily] (according to UniProt)
  • Effectors of protein activity

  • [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] acts as antagonist of SigW (anti-SigW)
  • Structure

  • [PDB|5WUQ] (complex with the cytoplasmic domain of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW]) [pubmed|28319136]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12076816], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced under conditions of alkali shock or in the presence of the toxin [protein|search|SdpC] ([protein|search|SigW]) [Pubmed|12207695]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • 1A905 ( ''sigW''::''erm''), [Pubmed|11244082], available at [ BGSC]
  • BKE01730 ([gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG
  • BKK01730 ([gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • [SW|Thomas Wiegert], University of Bayreuth, Germany [ Wiegert-Dateien/Thomas Wiegert.html Homepage]
  • References


  • 22381678,24921931,26901131,27344142,29343670
  • The [SW|SigW regulon]

  • 9683469,16629676,17675383,11866510,9987136,10960106,23934352,23155385
  • Other original publications

  • 11222589,14993308,16816000,17338440,12207695,11454200,14563871,12076816,19820159,21821766,22344650,14993308,23185515,20817771,21542858,22178969,27137497,27977677,28319136,29454936