SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DNA polymerase I, required for repair of UV- or MMS-induced DNA damage, processing of Okazaki fragments
98.89 kDa
protein length
880 aa Sequence Blast
gene length
2643 bp Sequence Blast
DNA replication
DNA polymerase I

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,973,182 2,975,824

    Phenotypes of a mutant

  • strongly reduced stationary phase mutagenesis [Pubmed|27399782]
  • The protein

    Catalyzed reaction/ biological activity

  • has DNA polymerase and 5'-3' exonuclease activity, but no 3'-5' exonuclease activity [Pubmed|16045613]
  • maturation of Okazaki fragments (together with [protein|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|RNase HIII]) [pubmed|30670546]
  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • Protein family

  • DNA polymerase type-A family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|ExoR]:
  • [SW|Domains]

  • 5'-3' exonuclease domain (aa 174-268) (according to UniProt)
  • 3'-5' exonuclease domain (aa 302-470) (according to UniProt)
  • Structure

  • [PDB|1XWL] (large fragment, corresponds to AA 310 to 880, Geobacillus stearothermophilus)
  • [SW|Localization]

  • recruited to replication forks after induction of DNA damage [pubmed|31251806]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|23396918], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials


  • BKE29090 ([gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTTCCTCCTAAGA, downstream forward: _UP4_TAAACAGAGATAGGAAGTGA
  • BKK29090 ([gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTTCCTCCTAAGA, downstream forward: _UP4_TAAACAGAGATAGGAAGTGA
  • References

  • 17114254,16045613,17905985,27399782,30670546,30726292,31251806