SubtiBank SubtiBank
polA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

polA

DNA polymerase I, required for repair of UV- or MMS-induced DNA damage, processing of Okazaki fragments
locus
BSU_29090
pI
4.92
mw
98.89 kDa
protein length
880 aa Sequence Blast
gene length
2643 bp Sequence Blast
function
DNA replication
product
DNA polymerase I
essential
no
ec
2.7.7.7
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,973,182 2,975,824

    Phenotypes of a mutant

  • a [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] double mutant is not viable (synthetic lethality) [pubmed|17114254]
  • strongly reduced stationary phase mutagenesis [Pubmed|27399782]
  • The protein

    Catalyzed reaction/ biological activity

  • has DNA polymerase and 5'-3' exonuclease activity, but no 3'-5' exonuclease activity [Pubmed|16045613]
  • maturation of Okazaki fragments (together with [protein|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|RNase HIII]) [pubmed|30670546]
  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • Protein family

  • DNA polymerase type-A family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|ExoR]:
  • [SW|Domains]

  • 5'-3' exonuclease domain (aa 174-268) (according to UniProt)
  • 3'-5' exonuclease domain (aa 302-470) (according to UniProt)
  • Structure

  • [PDB|6VDE] (from Mycobacterium smegmatis, 40.5% identity) [pubmed|32034423]
  • [PDB|1XWL] (large fragment, corresponds to AA 310 to 880, Geobacillus stearothermophilus)
  • [SW|Localization]

  • recruited to replication forks after induction of DNA damage [pubmed|31251806]
  • Expression and Regulation

    Operons

    genes
    [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]-[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]-[gene|3BEE8E248BC583FCCB37B7A209A122DD93CD398C|ytaF]-[gene|E163A282560DB882B81E783E7E95E1960F4AE4D2|ytaG]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|23396918], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP3532 (Δ[gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]::spec), available in [SW|Jörg Stülke]'s lab
  • BKE29090 ([gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTTCCTCCTAAGA, downstream forward: _UP4_TAAACAGAGATAGGAAGTGA
  • BKK29090 ([gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTTCCTCCTAAGA, downstream forward: _UP4_TAAACAGAGATAGGAAGTGA
  • References

  • 17114254,16045613,17905985,27399782,30670546,30726292,31251806,32034423