SubtiBank SubtiBank
yvcA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvcA

required for complex colony development
locus
BSU_34850
pI
6.83
mw
27.72 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
function
complex colony development
product
lipoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,581,965 3,582,690

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]-[gene|56A098AF47D293AA2EC6E7E7EC2626A832BA51CD|yvcB]-[gene|F83570E87B0B3C09A17ECC60365EDF9B448C490F|yvzA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18978066], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|17590234], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A379 (yvcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/379 NBRP B. subtilis, Japan]
  • BKE34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT, downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
  • BKK34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT, downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
  • References

  • 18978066,17590234