SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


required for complex colony development
27.72 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
complex colony development

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,581,965 3,582,690

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18978066], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|17590234], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    Biological materials


  • MGNA-A379 (yvcA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT, downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
  • BKK34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT, downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
  • References

  • 18978066,17590234