SubtiBank SubtiBank
yvcA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvcA

required for complex colony development
locus
BSU_34850
pI
6.83
mw
27.72 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
function
complex colony development
product
lipoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,581,965 3,582,690

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]-[gene|56A098AF47D293AA2EC6E7E7EC2626A832BA51CD|yvcB]-[gene|F83570E87B0B3C09A17ECC60365EDF9B448C490F|yvzA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18978066], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|17590234], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A379 (yvcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/379 NBRP B. subtilis, Japan]
  • BKE34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT, downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
  • BKK34850 ([gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGAACCTCCACGGGT, downstream forward: _UP4_TTAATAGATAAAAAGGAGAA
  • References

  • 18978066,17590234