SubtiBank SubtiBank
motP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

motP

Na+-coupled [protein|3D42584D65D80A1C73F057714647E29FF6BBD58A|MotP]-[protein|search|MotS ]flagellar stator
locus
BSU_29730
pI
9.19
mw
29.99 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
function
[SW|motility and chemotaxis]
product
motility protein (flagellar motor rotation)
essential
no
synonyms
ytxD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,043,284 3,044,102

    The protein

    Protein family

  • motA family (with [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA], according to UniProt)
  • Paralogous protein(s)

  • [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]-[gene|3D42584D65D80A1C73F057714647E29FF6BBD58A|motP]-[gene|6617D785D08C5919F0B774D2AF9EA6A84215486B|motS]
    description
    [Pubmed|16547058]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B526 (ytxD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1525 NBRP B. subtilis, Japan]
  • BKE29730 ([gene|3D42584D65D80A1C73F057714647E29FF6BBD58A|motP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCTCCCCATGAAA, downstream forward: _UP4_GTAAAAACAAAAAAGGGATC
  • BKK29730 ([gene|3D42584D65D80A1C73F057714647E29FF6BBD58A|motP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCTCCCCATGAAA, downstream forward: _UP4_GTAAAAACAAAAAAGGGATC
  • References

  • 16095621,15306009,24771657,16547058,25273986,28378843,29109979,16095621