SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


formylmethionine deformylase
17.63 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
formylmethionine deformylase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein maturation]
  • Gene

    1,646,512 1,646,994

    Phenotypes of a mutant

  • a ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant is not viable unless the cells acquire suppressor mutations in ''[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt], [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]'' or ''[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]'' [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + N-terminal N-formyl-L-methionyl-[peptide] --> formate + N-terminal L-methionyl-[peptide] (according to UniProt)
  • Protein family

  • polypeptide deformylase family (with [protein|53B760316B19E142FC3ECAD2CFAA540377B08BBC|DefB], according to UniProt)
  • Paralogous protein(s)

  • [protein|53B760316B19E142FC3ECAD2CFAA540377B08BBC|DefB]
  • Structure

  • [PDB|1WS0] (from B.cereus, 67% identity) [pubmed|16049914]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16964327], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab



  • [pubmed|22383849]
  • view in new tab

    Biological materials


  • BKE15720 ([gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGTTACCCTCCAAGA, downstream forward: _UP4_CTAGCGGATATGGAAGGATG
  • BKK15720 ([gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGTTACCCTCCAAGA, downstream forward: _UP4_CTAGCGGATATGGAAGGATG
  • References

  • 11429456,12627383,18288106,16964327,23770820,27983482,16049914