SubtiBank SubtiBank
defA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

defA

formylmethionine deformylase
locus
BSU15720
pI
4.73
mw
17.63 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
translation
product
formylmethionine deformylase
essential
no
ec
3.5.1.88
synonyms
yloK,def

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.1|Protein maturation]
  • Gene

    Coordinates
    1,646,512 1,646,994

    Phenotypes of a mutant

  • a ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant is not viable unless the cells acquire suppressor mutations in ''[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt], [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]'' or ''[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]'' [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • Formyl-L-methionyl peptide + H2O = formate + methionyl peptide (according to Swiss-Prot)
  • Protein family

  • polypeptide deformylase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|53B760316B19E142FC3ECAD2CFAA540377B08BBC|DefB]
  • Structure

  • [PDB|1WS0] (from B.cereus, 67% identity) [pubmed|16049914]
  • Expression and Regulation

    Operons

    genes
    [gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]
    description
    [Pubmed|16964327]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16964327], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]-[gene|2B67C63442F28F6BCBA3BA6DE4B563C73E8DF16C|yloI]-[gene|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|priA]-[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]

    description

  • [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15720 ([gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGTTACCCTCCAAGA, downstream forward: _UP4_CTAGCGGATATGGAAGGATG
  • BKK15720 ([gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGTTACCCTCCAAGA, downstream forward: _UP4_CTAGCGGATATGGAAGGATG
  • References

  • 11429456,12627383,18288106,16964327,23770820,27983482,16049914